Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU015511

Sigma-Aldrich

MISSION® esiRNA

targeting human PLG

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTCCACTTCTCCCCACAGACCTAGATTCTCACCTGCTACACACCCCTCAGAGGGACTGGAGGAGAACTACTGCAGGAATCCAGACAACGATCCGCAGGGGCCCTGGTGCTATACTACTGATCCAGAAAAGAGATATGACTACTGCGACATTCTTGAGTGTGAAGAGGAATGTATGCATTGCAGTGGAGAAAACTATGACGGCAAAATTTCCAAGACCATGTCTGGACTGGAATGCCAGGCCTGGGACTCTCAGAGCCCACACGCTCATGGATACATTCCTTCCAAATTTCCAAACAAGAACCTGAAGAAGAATTACTGTCGTAACCCCGATAGGGAGCTGCGGCCTTGGTGTTTCACCACCGACCCCAACAAGCGCTGGGAACTTTGTGACATCCCCCGCTGCACAACACCTCCACCATCTTCTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pankaj K Singh et al.
Molecular cancer therapeutics, 18(12), 2381-2393 (2019-08-10)
Distinct metabolic vulnerabilities of cancer cells compared with normal cells can potentially be exploited for therapeutic targeting. Deficiency of argininosuccinate synthetase-1 (ASS1) in pancreatic cancers creates auxotrophy for the semiessential amino acid arginine. We explored the therapeutic potential of depleting
Uttam Satyal et al.
ACS applied materials & interfaces, 9(35), 29481-29495 (2017-08-16)
This article presents the synthesis, self-assembly, and biological activity as transfection agents for pDNA, siRNA, and mRNA of novel pyridinium pseudogemini surfactants, interfacially engineered from the most efficient gemini surfactants and lipids generated in our amphiphile research program. Formulation of
Liuping Wei et al.
Cellular signalling, 26(7), 1476-1488 (2014-03-25)
We have established that 15-hydroxyeicosatetraenoic acid is an important factor in regulation of pulmonary vascular remodeling (PVR) associated with hypoxia-induced pulmonary hypertension (PH), which is further metabolized by 15-hydroxyprostaglandin dehydrogenase (15-PGDH) to form 15-ketoeicosatetraenoic acid (15-KETE). However, the role of
Karen A Newell-Litwa et al.
The Journal of cell biology, 210(2), 225-242 (2015-07-15)
RhoGTPases organize the actin cytoskeleton to generate diverse polarities, from front-back polarity in migrating cells to dendritic spine morphology in neurons. For example, RhoA through its effector kinase, RhoA kinase (ROCK), activates myosin II to form actomyosin filament bundles and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service