Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU016631

Sigma-Aldrich

MISSION® esiRNA

targeting human TXNIP

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCACACTTACCTTGCCAATGGCCAGACCAAGGTGCTGACTCAGAAGTTGTCATCAGTCAGAGGCAATCATATTATCTCAGGGACATGCGCATCATGGCGTGGCAAGAGCCTTCGGGTTCAGAAGATCAGGCCTTCTATCCTGGGCTGCAACATCCTTCGAGTTGAATATTCCTTACTGATCTATGTTAGCGTTCCTGGATCCAAGAAGGTCATCCTTGACCTGCCCCTGGTAATTGGCAGCAGATCAGGTCTAAGCAGCAGAACATCCAGCATGGCCAGCCGAACCAGCTCTGAGATGAGTTGGGTAGATCTGAACATCCCTGATACCCCAGAAGCTCCTCCCTGCTATATGGATGTCATTCCTGAAGATCACCGATTGGAGAGCCCAACCACTCCTCTGCTAGATGACATGGATGGCTCTCAAG

Ensembl | human accession no.

ENSG00000117289

NCBI accession no.

NM_006472

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TXNIP(10628) , TXNIP(10628)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Takhellambam S Devi et al.
Biology open, 8(4) (2019-04-27)
Thioredoxin-interacting protein (TXNIP) plays a critical role in oxidative stress, inflammation, apoptosis and the pathogenesis of diabetic retinopathy (DR). However, the role of TXNIP in high glucose-induced retinal pigment epithelium (RPE) dysfunction is still unknown. Here, we show that high
Jianjun Jiang et al.
Lipids in health and disease, 20(1), 19-19 (2021-02-23)
This study aimed to explore the effects of ceramide (Cer) on NLRP3 inflammasome activation and their underlying mechanisms. Lipopolysaccharide (LPS)/adenosine triphosphate (ATP)-induced NLRP3 inflammasome activation in J774A.1 cells and THP-1 macrophages was used as an in vitro model of inflammation.
Tina Oberacker et al.
FEBS letters, 592(13), 2297-2307 (2018-06-14)
The "free radical theory of aging" suggests that reactive oxygen species (ROS) are responsible for age-related loss of cellular functions and, therefore, represent the main cause of aging. Redox regulation by thioredoxin-1 (TRX) plays a crucial role in responses to
Qing Zhao et al.
Journal of neuroinflammation, 14(1), 104-104 (2017-05-12)
Early brain injury (EBI) is considered a major contributor to the high morbidity and mortality associated with subarachnoid haemorrhage (SAH). Both of sterile inflammation and apoptosis are considered the important causes of EBI. Recently, it was confirmed that thioredoxin-interacting protein
Chad N Brocker et al.
Nature communications, 11(1), 5847-5847 (2020-11-19)
Exploring the molecular mechanisms that prevent inflammation during caloric restriction may yield promising therapeutic targets. During fasting, activation of the nuclear receptor peroxisome proliferator-activated receptor α (PPARα) promotes the utilization of lipids as an energy source. Herein, we show that
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service