Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU025821

Sigma-Aldrich

MISSION® esiRNA

targeting human CDKN1B

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTTAACCCGGGACTTGGAGAAGCACTGCAGAGACATGGAAGAGGCGAGCCAGCGCAAGTGGAATTTCGATTTTCAGAATCACAAACCCCTAGAGGGCAAGTACGAGTGGCAAGAGGTGGAGAAGGGCAGCTTGCCCGAGTTCTACTACAGACCCCCGCGGCCCCCCAAAGGTGCCTGCAAGGTGCCGGCGCAGGAGAGCCAGGATGTCAGCGGGAGCCGCCCGGCGGCGCCTTTAATTGGGGCTCCGGCTAACTCTGAGGACACGCATTTGGTGGACCCAAAGACTGATCCGTCGGACAGCCAGACGGGGTTAGCGGAGCAATGCGCAGGAATAAGGAAGCGACCTGCAACCGACGATTCTTCTACTCAAAACAAAAGAGCCAACAGAACAGAAGAAAATGTTTCAGACGGTTCCCCAAATGCCGGTTCTGTGGAGCAGACGCCCAAGAAGCCTGGCCTCAGAAGACGTCAAACGTAAACAGCTCG

Ensembl | human accession no.

ENSG00000111276

NCBI accession no.

NM_004064

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CDKN1B(1027) , CDKN1B(1027)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Galit Ankri-Eliahoo et al.
Journal of vascular surgery, 63(5), 1351-1359 (2015-02-24)
The natural response to arterial occlusive disease is enlargement of collaterals; however, the molecular factors that control collateralization are not well understood. The gene p27(Kip1) (p27) affects human response to arterial injury. Previous studies have shown that overexpression of p27
Alessandra Verdina et al.
Journal of translational medicine, 6, 27-27 (2008-05-24)
Nonsteroidal anti-inflammatory drugs (NSAIDs) have been proposed for prevention and treatment of a variety of human cancers. Piroxicam, in particular, has been recently shown to exert significant anti-tumoral activity in combination with cisplatin (CDDP) on mesothelioma cells. However, the mechanisms
Huimin Wang et al.
Oncology research, 25(9), 1431-1440 (2017-01-22)
Nasopharyngeal carcinoma (NPC) is a common malignancy of the head and neck that arises from the nasopharynx epithelium and is highly invasive. Cyclin-dependent kinase inhibitor 3 (CDKN3) belongs to the dual-specificity protein phosphatase family, which plays a key role in
Takayuki Satoh et al.
Scientific reports, 6, 27829-27829 (2016-06-11)
Potent anti-cancer compounds FR901464 and its methyl-ketal derivative spliceostatin A (SSA) inhibit cell cycle progression at G1 and G2/M phases. These compounds bind to the spliceosome and inhibit the splicing reaction. However, the molecular mechanism underlying G1 arrest after SSA
Ela Alcántara-Flores et al.
Molecules (Basel, Switzerland), 20(12), 21125-21137 (2015-12-04)
Argentatin B has been shown to inhibit the growth of colon HCT-15, and prostate PC-3 cancer cells. However, the mechanism by which argentatin B inhibits cell proliferation is still unknown. We aimed to investigate the mechanism by which argentatin B
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service