Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU034701

Sigma-Aldrich

MISSION® esiRNA

targeting human ROCK1 (2)

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGACAGAATCGGACACAGCTGTAAGATTGAGGAAGAGTCACACAGAGATGAGCAAGTCAATTAGTCAGTTAGAGTCCCTGAACAGAGAGTTGCAAGAGAGAAATCGAATTTTAGAGAATTCTAAGTCACAAACAGACAAAGATTATTACCAGCTGCAAGCTATATTAGAAGCTGAACGAAGAGACAGAGGTCATGATTCTGAGATGATTGGAGACCTTCAAGCTCGAATTACATCTTTACAAGAGGAGGTGAAGCATCTCAAACATAATCTCGAAAAAGTGGAAGGAGAAAGAAAAGAGGCTCAAGACATGCTTAATCACTCAGAAAAGGAAAAGAATAATTTAGAGATAGATTTAAACTACAAACTTAAATCATTACAACAACGGTTAGAACAAGAGGTAAATGAACACAAAGTAACCAAAGCTCGTTTAACTGACAAACATCAATCTATTGAAGAGGCAAAGTCTGTGGC

Ensembl | human accession no.

ENSG00000067900

NCBI accession no.

NM_005406

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ROCK1(6093) , ROCK1(6093)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Gentao Fan et al.
Frontiers in bioscience (Landmark edition), 24, 1167-1177 (2019-05-29)
miR-139 has a tumor suppressor effect in many tumors. Here, we examined the suppressive role of this miRNA and its target, ROCK1, in osteosarcoma (OS), a highly malignant bone tumor that mainly affects children and adolescents. The expression of miR-139
Wen-Di Zhou et al.
International journal of oncology, 51(6), 1831-1841 (2017-10-19)
Actein is a tetracyclic triterpenoid compound, extracted from the rhizome of Cimicifuga foetida, exhibiting anticancer activities as previously reported. However, the effects of actein on human leukemia have not been explored before. In this study, the role of actein in
Dongmei Wang et al.
OncoTargets and therapy, 13, 361-370 (2020-02-06)
Propofol has been identified to perform anti-tumor functions in glioma. However, the molecular mechanisms underlying propofol-induced prevention on migration and invasion of glioma cells remain unclear. Cell proliferation, invasion and migration were measured by 3-(4,5)-dimethylthiahiazo(-z-y1)-3,5-di-phenytetrazoliumromide assay and transwell assay, respectively.
Yong Wang et al.
Molecular cancer, 17(1), 89-89 (2018-05-14)
Accumulating evidences indicate that non-coding RNAs (ncRNAs) including long non-coding RNAs (lncRNAs) and microRNAs (miRNAs) acting as crucial regulators in osteosarcoma (OS). Previously, we reported that Rho associated coiled-coil containing protein kinase 1 (ROCK1), a metastatic-related gene was negatively regulated
Clarissa N Amaya et al.
BMC cancer, 17(1), 485-485 (2017-07-16)
The serine/threonine protein kinases ROCK1 and 2 are key RhoA-mediated regulators of cell shape and cytoskeletal dynamics. These proteins perform multiple functions in vascular endothelial cell physiology and are attractive targets for cancer therapy based on their roles as oncogenes
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service