Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU048191

Sigma-Aldrich

MISSION® esiRNA

targeting human SNAI2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCGGACCCACACATTACCTTGTGTTTGCAAGATCTGCGGCAAGGCGTTTTCCAGACCCTGGTTGCTTCAAGGACACATTAGAACTCACACGGGGGAGAAGCCTTTTTCTTGCCCTCACTGCAACAGAGCATTTGCAGACAGGTCAAATCTGAGGGCTCATCTGCAGACCCATTCTGATGTAAAGAAATACCAGTGCAAAAACTGCTCCAAAACCTTCTCCAGAATGTCTCTCCTGCACAAACATGAGGAATCTGGCTGCTGTGTAGCACACTGAGTGACGCAATCAATGTTTACTCGAACAGAATGCATTTCTTCACTCCGAAGCCAAATGACAAATAAAGTCCAAAGGCATTTTCTCCTGTGCTGACCAACCAAATAATATGTATAGACACACACACATATGCACACACACACACACACACCCACAGAGAGAGAGCTGCAAGAGCATGGAATTCA

Ensembl | human accession no.

ENSG00000019549

NCBI accession no.

NM_003068

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SNAI2(6591) , SNAI2(6591)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Carla L Alves et al.
Breast cancer research : BCR, 20(1), 60-60 (2018-06-21)
Endocrine resistance in estrogen receptor-positive (ER+) breast cancer is a major clinical problem and is associated with accelerated cancer cell growth, increased motility and acquisition of mesenchymal characteristics. However, the specific molecules and pathways involved in these altered features remain
Di-Di Chen et al.
American journal of physiology. Gastrointestinal and liver physiology, 317(2), G147-G160 (2019-04-04)
Invasion and metastasis are responsible for the majority of deaths in gastric cancer (GC). microRNA-33a (miR-33a) might function as a tumor suppressor in multiple cancers. Here, we describe the regulation and function of miR-33a in GC and mechanisms involved in
Dong Hyun Jo et al.
Oncotarget, 8(9), 15441-15452 (2017-01-07)
Retinoblastoma is the most common intraocular cancer in children, affecting 1/20,000 live births. Currently, children with retinoblastoma were treated with chemotherapy using drugs such as carboplatin, vincristine, and etoposide. Unfortunately, if conventional treatment fails, the affected eyes should be removed
Mijung Kwon et al.
Oncotarget, 7(47), 77052-77070 (2016-10-25)
Filamin A interacting protein 1-like (FILIP1L) is an inhibitor of the canonical WNT pathway. WNT/β-catenin signaling and its downstream pathway, epithelial-to-mesenchymal transition (EMT), play a key role in ovarian cancer metastasis and chemoresistance. To study the clinical implications of FILIP1L
Ziliang Wang et al.
Oncotarget, 6(9), 6670-6683 (2015-03-10)
While Aurora-A (Aur A) provokes, BRCA2 restrains primary tumorigenesis, the roles of Aur A and BRCA2 in cancer metastasis remains unclear. Here, we show that the metastatic promoting markers SLUG, FBN1, and MMP2, 9, 13 are either stimulated or suppressed
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service