Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU071121

Sigma-Aldrich

MISSION® esiRNA

targeting human NLRP3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCTGGAGGATGTGGACTTGAAGAAATTTAAGATGCACTTAGAGGACTATCCTCCCCAGAAGGGCTGCATCCCCCTCCCGAGGGGTCAGACAGAGAAGGCAGACCATGTGGATCTAGCCACGCTAATGATCGACTTCAATGGGGAGGAGAAGGCGTGGGCCATGGCCGTGTGGATCTTCGCTGCGATCAACAGGAGAGACCTTTATGAGAAAGCAAAAAGAGATGAGCCGAAGTGGGGTTCAGATAATGCACGTGTTTCGAATCCCACTGTGATATGCCAGGAAGACAGCATTGAAGAGGAGTGGATGGGTTTACTGGAGTACCTTTCGAGAATCTCTATTTGTAAAATGAAGAAAGATTACCGTAAGAAGTACAGAAAGTACGTGAGAAGCAGATTCCAGTGCATTGAA

Ensembl | human accession no.

ENSG00000162711

NCBI accession no.

NM_183395

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NLRP3(114548) , NLRP3(114548)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

S F Khaiboullina et al.
Scientific reports, 7(1), 16050-16050 (2017-11-24)
ZIKV causes microcephaly by crossing the placental barrier, however, the mechanism of trans-placental dissemination of ZIKV remains unknown. Here, we sought to determine whether monocytes, which can cross tissue barriers, assist ZIKV dissemination to the fetus. We determined this by infecting monocytes
Maureen C Ty et al.
EMBO molecular medicine, 11(8), e9903-e9903 (2019-07-03)
Malaria is a highly inflammatory disease caused by Plasmodium infection of host erythrocytes. However, the parasite does not induce inflammatory cytokine responses in macrophages in vitro and the source of inflammation in patients remains unclear. Here, we identify oxidative stress, which
Sheng-Tao Yao et al.
Journal of molecular neuroscience : MN, 61(3), 385-395 (2016-12-10)
Complement-mediated inflammation plays a vital role in intracerebral hemorrhage (ICH), implicating pro-inflammatory factor interleukin-1beta (IL-1β) secretion. Brain samples and contralateral hemiencephalon were all collected and detected by Western blot. NLRP3 expression was located by dual immunofluorescence staining at 1, 3
Zhe Lin et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(9 Pt B), 2890-2900 (2018-06-03)
Oxidative stress and inflammation are closely related to cardiovascular diseases. Although hydrogen sulfide (H2S) has been shown to have powerful anti-oxidative and anti-inflammatory properties, its role in macrophage inflammation was poorly understood. The aim of this study was to investigate
Qin Hu et al.
BioFactors (Oxford, England), 44(2), 123-136 (2017-12-02)
Increasing evidence demonstrates that pyroptosis, pro-inflammatory programmed cell death, is linked to atherosclerosis; however, the underlying mechanisms remain to be elucidated. Dihydromyricetin (DHM), a natural flavonoid, was reported to exert anti-oxidative and anti-inflammatory bioactivities. However, the effect of DHM on
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service