Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU140181

Sigma-Aldrich

MISSION® esiRNA

targeting human PAK1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATAGTGAGTGTGGGCGATCCTAAGAAGAAATATACACGGTTTGAGAAGATTGGACAAGGTGCTTCAGGCACCGTGTACACAGCAATGGATGTGGCCACAGGACAGGAGGTGGCCATTAAGCAGATGAATCTTCAGCAGCAGCCCAAGAAAGAGCTGATTATTAATGAGATCCTGGTCATGAGGGAAAACAAGAACCCAAACATTGTGAATTACTTGGACAGTTACCTCGTGGGAGATGAGCTGTGGGTTGTTATGGAATACTTGGCTGGAGGCTCCTTGACAGATGTGGTGACAGAAACTTGCATGGATGAAGGCCAAATTGCAGCTGTGTGCCGTGAGTGTCTGCAGGCTCTGGAGTTCTTGCATTCGAACCAGGTCATTCACAGAGACATCAAGAGTGACAATATTCTGTTGGGAATGGATGGCTCTGTCAAGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Guiling Wang et al.
Oncotarget, 6(12), 9877-9886 (2015-04-19)
To date, microrchidia (MORC) family CW-type zinc-finger 2 (MORC2), has been found to be involved in p21-activated kinase1 (PAK1) pathway to maintain genomic integrity. Here, we explore its novel role in cancer. We demonstrate that PAK1-mediated MORC2 phosphorylation promotes cell
Nikhlesh K Singh et al.
The Journal of biological chemistry, 292(34), 14080-14091 (2017-06-29)
Although the involvement of Rho proteins in the pathogenesis of vascular diseases is well studied, little is known about the role of their upstream regulators, the Rho guanine nucleotide exchange factors (RhoGEFs). Here, we sought to identify the RhoGEFs involved
Juan Tang et al.
Oncotarget, 6(33), 34831-34845 (2015-10-27)
Oscillations in intracellular Ca2+ concentrations ([Ca2+]i) mediate various cellular function. Although it is known that [Ca2+]i oscillations are susceptible to dysregulation in tumors, the tumor-specific regulators of [Ca2+]i oscillations are poorly characterized. We discovered that CD147 promotes hepatocellular carcinoma (HCC)
Anna E Dart et al.
The Journal of cell biology, 211(4), 863-879 (2015-11-26)
P21-activated kinase 4 (PAK4) is a Cdc42 effector protein thought to regulate cell adhesion disassembly in a kinase-dependent manner. We found that PAK4 expression is significantly higher in high-grade human breast cancer patient samples, whereas depletion of PAK4 modifies cell
Alexandre K Rouquette-Jazdanian et al.
PloS one, 10(6), e0131823-e0131823 (2015-06-30)
Linker for Activation of T cells (LAT) is an adapter protein that is essential for T cell function. Knock-in mice with a LAT mutation impairing calcium flux develop a fatal CD4+ lymphoproliferative disease. miR-155 is a microRNA that is correlated

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service