Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU147931

Sigma-Aldrich

MISSION® esiRNA

targeting human AREG

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAAAGGGAGGCAAAAATGGAAAAAATAGAAGAAACAGAAAGAAGAAAAATCCATGTAATGCAGAATTTCAAAATTTCTGCATTCACGGAGAATGCAAATATATAGAGCACCTGGAAGCAGTAACATGCAAATGTCAGCAAGAATATTTCGGTGAACGGTGTGGGGAAAAGTCCATGAAAACTCACAGCATGATTGACAGTAGTTTATCAAAAATTGCATTAGCAGCCATAGCTGCCTTTATGTCTGCTGTGATCCTCACAGCTGTTGCTGTTATTACAGTCCAGCTTAGAAGACAATACGTCAGGAAATATGAAGGAGAAGCTGAGGAACGAAAGAAACTTCGACAAGAGAATGGAAATGTACATGCTATAGCATAACTGAAGATAAAATTACAGGATATCACATTGGAGTCACTGCCAAGTCATAGCCA

Ensembl | human accession no.

ENSG00000109321

NCBI accession no.

NM_001657

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... AREG(374) , AREG(374)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jian Wang et al.
Cellular signalling, 53, 122-131 (2018-10-07)
Ambient particulate matter (PM) promotes the development and exacerbation of chronic respiratory diseases, including chronic obstructive pulmonary disease (COPD) and asthma, by increasing inflammation and mucus hypersecretion. However, the biological mechanisms underlying PM-induced airway inflammation and mucus hypersecretion remain unclear.
Simona Taverna et al.
Scientific reports, 7(1), 3170-3170 (2017-06-11)
Non-small cell lung cancer (NSCLC) remains the leading cause of cancer-related deaths worldwide. The majority of patients are diagnosed in advanced disease stage. Bone metastasis is the most frequent complication in NSCLC resulting in osteolytic lesions. The perfect balance between
Shuntaro Tokunaga et al.
Anticancer research, 37(5), 2225-2231 (2017-05-10)
Amrubicin (AMR) has shown promising activity for lung cancer. However, little is known about the mechanism underlying resistance to this agent. The aim of this study was to elucidate the mechanism underlying resistance to AMR. We first developed amrubicinol (AMR-OH)-resistant
Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Valerie N Barton et al.
Molecular cancer therapeutics, 14(3), 769-778 (2015-02-26)
Triple-negative breast cancer (TNBC) has the lowest 5-year survival rate of invasive breast carcinomas, and currently there are no approved targeted therapies for this aggressive form of the disease. The androgen receptor (AR) is expressed in up to one third
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service