Skip to Content
MilliporeSigma
All Photos(1)

Documents

EMU078861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ep300

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTGTCCTTCACCACGAGATCATCTGGCCATCTGGGTTTGTCTGTGATGGCTGTTTAAAGAAAACTGCACGAACTAGGAAAGAAAATAAGCTTTCTGCTAAAAGATTGCCATCTACCAGACTTGGGACCTTTCTGGAGAATCGAGTGAATGACTTTCTGAGGCGACAAAATCACCCTGAATCAGGAGAGGTCACTGTTCGGGTTGTTCATGCTTCTGACAAAACTGTGGAAGTGAAACCAGGCATGAAAGCAAGGTTTGTAGATAGTGGAGAGATGGCAGAATCTTTTCCATACCGAACAAAGGCCCTGTTTGCCTTTGAAGAAATTGATGGTGTTGACTTGTGTTTCTTCGGCATGCATGTTCAAGAATATGGCTCTGACTGCCCCCCTCCCAACCAGAGGAGGGTATACATATCTTACCTCGATAGTGTTCATTTCTTCCGTCCTAAATGCTTGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Guanqiao Wang et al.
Cellular signalling, 27(7), 1369-1379 (2015-04-07)
Carbonic anhydrase IX(CA9)is a member of the carbonic anhydrase family that catalyzes the reversible hydration of carbon dioxide, and plays a key role in the regulation of pH. Although a large number of studies have shown that CA9 is strongly
Erli Zhang et al.
PloS one, 10(12), e0143814-e0143814 (2015-12-03)
Endothelial senescence plays crucial roles in diabetic vascular complication. Recent evidence indicated that transient hyperglycaemia could potentiate persistent diabetic vascular complications, a phenomenon known as "metabolic memory." Although SIRT1 has been demonstrated to mediate high glucose-induced endothelial senescence, whether and
Jihong Chen et al.
Scientific reports, 5, 13727-13727 (2015-09-12)
Skeletal myogenesis is a highly ordered process which specifically depends on the function of transcriptional coactivator p300. Previous studies have established that Akt/protein kinase B (PKB), a positive regulator of p300 in proliferating cells, is also important for proper skeletal
Smita S Ghare et al.
Journal of immunology (Baltimore, Md. : 1950), 193(1), 412-421 (2014-06-06)
Activation-induced Fas ligand (FasL) mRNA expression in CD4+ T cells is mainly controlled at transcriptional initiation. To elucidate the epigenetic mechanisms regulating physiologic and pathologic FasL transcription, TCR stimulation-responsive promoter histone modifications in normal and alcohol-exposed primary human CD4+ T

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service